Authors: Scott Diede & Stephen Tapscott
Abstract
Earlier work from our laboratory focused on identifying regions of the genome susceptible to DNA palindrome formation, a rate-limiting step in gene amplification. We described a method to obtain a genome-wide analysis of palindrome formation (GAPF) based on the efficient intrastrand base pairing in large palindromic sequences (1). Palindromic sequences can rapidly anneal intramolecularly to form ‘snap-back’ DNA under conditions that do not favor intermolecular annealing. This snap-back property is used to enrich for palindromic sequences in total genomic DNA by denaturing the DNA at 100˚C, rapidly renaturing it by cooling, and then digesting the mixture with the single-strand specific nuclease S1. Snap-back DNA formed from palindromes is double-stranded and resistant to S1, whereas the remainder of genomic DNA is single-stranded and thus is sensitive to S1 digestion. Using GAPF, we have shown that de novo palindromes can form in cancers, and direct molecular analysis validated that a subset of these GAPF-positive signals represent cancer-specific palindromes located at the boundary of gene amplicons (1,2). We recently discovered that the original GAPF protocol also enriches for differentially methylated DNA (3). We now describe a modification of GAPF to increase the stringency of denaturation using 50% formamide to make the assay specific for DNA palindromes.
Reagents
- KpnI
- SbfI
- Formamide
- 3M NaCl (Invitrogen; included in S1 nuclease kit)
- S1 nuclease (Invitrogen)
- ChargeSwitch PCR Clean-Up Kit (Invitrogen)
- MseI
- MspI
- T4 DNA Ligase (NEB)
- Amicon Ultra-0.5, Ultracel-50 Membrane, 50 kDa (Millipore)
- Amicon Ultra-0.5, Ultracel-30 Membrane, 30 kDa (Millipore)
- 1/10 TE (1 mM Tris, 0.1 mM EDTA, pH 8.0)
- FastStart Taq DNA polymerase (Roche)
- 2 mM dNTPs for PCR
- DNase I (NEB)
- GeneChip WT Double-stranded Target Labeling Kit (Affymetrix)
- Tiling Array (Affymetrix)
Primers
- JW-102g GCGGTGACCCGGGAGATCTGAATTG
- JW103pcTA [Phos]TACAATTCAGATCTCCCG
- JW103pc-2 [Phos]CGCAATTCAGATCTCCCG
- JW-102gMse GCGGTGACCCGGGAGATCTGAATTGTAA
- JW-102gMsp GCGGTGACCCGGGAGATCTGAATTGCGG
Linker annealing
- MseI linker: JW-102g is annealed to JW103pcTA.
MspI linker: JW-102g is annealed to JW103pc-2
Mix 100 μl of 100 pmol/μl of each appropriate primer
Add 6.9 μl 3M NaCl and mix
Place in boiling water bath for 7 minutes
Turn off heat, let sit on hot plate >2 hours to cool
Add 20 μl 3M NaOAc, pH 5.2
Add 400 μl 100% cold EtOH
Mix and place at -20˚C for >2 hours
Spin at 4˚C for 20 minutes
Wash with 0.7 ml 70% cold EtOH
Spin at 4˚C for 20 minutes
- discard supernatant
- SpeedVac without heat to dryness
Dissolve DNA in 500 μl water
Equipment
- Microcentrifuge
- PCR thermocycler
- MagnaRack magnetic rack (Invitrogen)
- Heat plate
- Nanodrop (or other UV spec)
- Optional: Bioanalyzer (Agilent)
Procedure
Restriction digest
- A total of 2 micrograms of genomic DNA is used as input into the GAPF assay.
- Split sample evenly into two 0.2 ml thin-walled PCR tubes.
- Using manufacturer’s supplied buffers, digest 1 µg of genomic DNA with KpnI (10 U) in final volume of 20 µl. In the other tube, digest 1 µg with SbfI (10 U) in a final volume of 20 µl. Incubate at 37˚C for 6 hours.
- Heat inactivate restriction enzymes by incubating samples at 65˚C for 20 minutes.
- May freeze sample (-20˚C) at this point
Snap-back
- From above step, combine restriction digestions into one tube (final volume = 40 µl).
- Add 3 µl of 3M NaCl, 45 µl formamide, and 2 µl water to tube. May make master mix if performing multiple reactions.
- Place in thermocycler preheated to 100˚C. Incubate for 7 minutes to denature DNA.
- Remove tube from thermocycler and immediately place in ice-water bath. Incubate for 7 minutes.
S1 digest
- To sample from previous step, add 8 µl 3M NaCl, 12 µl 10x S1 nuclease buffer, 8 µl water and 1 µl S1 nuclease (200 U/µl). May make master mix if performing multiple reactions.
- Note: Dilute stock of S1 nuclease (~1000 U/µl) in Dilution buffer to obtain 200 U/µl.
- Incubate at 37˚C for 60 minutes.
DNA clean-up
- For most consistent results, use ChargeSwitch PCR Clean-Up Kit (Invitrogen) to purify DNA. Alternatively, one may purify DNA using phenol:chloroform extraction followed by ethanol precipitation (use glycogen as carrier). Resuspend DNA pellet in 84 µl 1/10 TE.
- Transfer S1 digested DNA to 1.7 ml microfuge tube.
- Add 120 μl Purification Buffer (N5) and mix.
- Add 10 μl Magnetic Beads and mix by pipetting up and down gently.
- Incubate 1 minute.
- Place sample on MagnaRack for 1 minute to pellet beads.
- Without removing tube from MagnaRack, remove and discard supernatant.
- Remove tube from MagnaRack.
- Add 150 μl of Wash Buffer.
- Pipet up and down gently to mix.
- Place sample on MagnaRack for 1 minute to pellet beads.
- Without removing tube from MagnaRack, remove and discard supernatant.
- Remove tube from MagnaRack.
- Add 150 μl of Wash Buffer.
- Pipet up and down gently to mix.
- Place sample on MagnaRack for 1 minute to pellet beads.
- Without removing tube from MagnaRack, remove and discard supernatant.
- Remove tube from MagnaRack.
- Add 84 μl of Elution Buffer (E5).
- Pipet up and down gently to mix.
- Incubate 1 minute.
- Place sample on MagnaRack for 1 minute to pellet beads.
- Without removing tube from MagnaRack, remove and save sample. Discard beads. A total of 80 µl will be used for next step in protocol. The leftover 4 µl can be used for PCR-based enrichment assays for quality control or troubleshooting.
- May freeze sample (-20˚C) at this point
Ligation-mediated PCR
Restriction digestion
- Using manufacturer’s supplied buffers, digest 40 µl of purified DNA from previous step with MseI (10 U) in final volume of 50 µl, and digest the other 40 µl of purified DNA with MspI (40 U) in final volume of 50 µl.
- Incubate for 37˚C for 2 hours.
- Heat inactivate MseI digest by incubating at 65˚C for 20 minutes; MspI digest requires incubation at 80˚C for 20 minutes for inactivation.
- May freeze sample (-20˚C) at this point
Linker ligation
- Add the following to the 50 µl restriction digest from previous step: 5 µl of appropriate linker (MseI or MspI linker), 7 µl 10x T4 DNA Ligase buffer, 7 µl water, and 1 µl T4 DNA ligase (400 U/µl).
- Incubate at 16˚C for 3 hours.
- Heat inactivate ligase by incubating at 70˚C for 20 minutes.
Remove unligated linkers
- To Amicon Ultracel-50 (50 kDa cutoff) Membrane 0.5 mL column, add 160 µl 1/10 TE and entire ligation mix (70 µl of either MseI or MspI ligation) from previous step.
- Spin 14,000 x g for 5-10 minutes until volume concentrated to ~20 µl.
- Recover DNA by placing inverted column into new tube and spinning at 1,000 x g for 2 minutes.
PCR amplification
Set up the following PCR reaction:
- 4 µl template DNA (from above)
- 10 µl 10x PCR Buffer
- 10 µl 2 mM dNTPs
- 12 µl Linker specific primer (10 pmol/μl; use either JW-102gMse or JW-102gMsp)
- 0.8 µl FastStart Taq (Roche)
- 20 µl 5x GC-rich solution
- 43.2 µl water
Cycling conditions
- 96˚C 6 minutes
- 96˚C 30 seconds
- 55˚C 30 seconds
- 72˚C 30 seconds
- 72˚C 7 minutes
- 4˚C Hold
Run 1 μl of 100 μl PCR sample on agarose gel for quality control (Average size range of Mse PCR 300-800 bp; Msp PCR 200-600 bp).
PCR clean-up
- To Amicon Ultracel-30 (30 kDa cutoff) Membrane 0.5 mL column, add 300 µl 1/10 TE and combined MseI and MspI PCR samples (~198 µl) from previous step.
- Spin 14,000 x g for 20-30 minutes until volume concentrated to ~20 µl.
- Recover DNA by placing inverted column into new tube and spinning at 1,000 x g for 2 minutes.
- Quantitate DNA by Nanodrop. Should get a little greater than 7.5 µg in total.
- May freeze sample (-20˚C) at this point
The following protocol is for labeling DNA for the Affymetrix Tiling Array platform. If a different platform is desired, please modify protocol from this point forward as needed.
DNA fragmentation
Perform in 0.2 mL PCR tube in a thermocycler:
3 µl of DNA may be used on Bioanalyzer (Agilent) to measure DNA fragmentation profile for quality control purposes. Results of the Bioanalyzer analysis of fragmented DNA should show that the majority of fragmented DNA is between 25 to 200 bases, with the peak of the distribution between 25 to 100 bases.
DNA labeling
Perform in 0.2 mL PCR tube in a thermocycler; Affy GeneChip WT Double-stranded Target Labeling Kit)
Sample now ready for hybridization to Tiling array and processing per Affymetrix protocol
Timing
2-3 days.
References
- Tanaka, H., Bergstrom, D.A., Yao, M-C., & Tapscott, S.J. Widespread and nonrandom distribution of DNA palindromes in cancer cells provides a structural platform for subsequent gene amplification. Nature Genetics 37, 320-7 (2005).
- Tanaka, H., Cao, Y., Bergstrom, D.A., Kooperberg, C., Tapscott, S.J., Yao, M-C. Intrastrand annealing leads to the formation of a large DNA palindrome and determines the boundaries of genomic amplification in human cancer. Molec. Cell. Biol. 27, 1993-2002 (2007).
- Diede, S.J., Guenthoer, J., Geng, L.N., Mahoney, S.E., Marotta, M., Olson, J.M., Tanaka, H., & Tapscott, S.J. Proc. Natl. Acad. Sci. USA 107, 234-9 (2010).
Associated Publications
Genome-wide analysis of palindrome formation. Scott J Diede, Hisashi Tanaka, Donald A Bergstrom, Meng-Chao Yao, and Stephen J Tapscott. Nature Genetics 42 (4) 279 - 279 doi:10.1038/ng0410-279
Author information
Scott Diede & Stephen Tapscott, Fred Hutchinson Cancer Research Center
Source: Protocol Exchange (2010) doi:10.1038/nprot.2010.59. Originally published online 5 August 2010.