Viruses Genetics and Genomics Microbiology

scientificprotocols authored almost 4 years ago

Authors: Rachel Graham

Abstract

This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of MERS-CoV genomes.

Introduction

This protocol details the steps, reagents, and conditions required to sequence MERS-CoV genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that MERS-CoV RNA purified using a standard procedure (i.e., TRIzol extraction) has already been performed.

Materials

  1. Invitrogen SuperScript III kit
  2. dNTPS (10 mM)
  3. Random Hexamers
  4. RNasin (if desired)
  5. Thermo Phusion PCR enzyme
  6. Primers (2 mM stock – see Tables 1 and 2)
  7. Agarose
  8. 1X TAE Buffer
  9. Ethidium Bromide

Equipment

  1. 70ºC water bath
  2. 55ºC water bath
  3. Thermal cycler

Procedure

Reverse Transcription:

  1. In a 1.5-µL Eppendorf tube, add 1-4 µL RNA and 1 µL Random Hexamers.
  2. Incubate at 70ºC for 5 min.
  3. Place reaction briefly on ice and assemble the reverse transcription reaction using the kit-supplied reagents (a master mix can be made if multiple reactions are being run):
    • 4 µL 5X First-Strand Buffer
    • 2 µL DTT
    • 1 µL SuperScript III reverse transcriptase
    • 1 µL dNTPs
    • 1 µL RNasin (if desired)
    • x µL H2O to 20 µL
  4. Incubate at 55ºC for 45 min to 1 h.
  5. Inactivate the reverse transcriptase at 70ºC for 15 min. Place reaction on ice after inactivation.
  6. Proceed with PCR setup.

PCR (with Phusion PCR kit):

  1. Assemble PCR reactions to generate amplicons according to those detailed in Table 2 (for whole-genome sequencing) or with any combination of forward and reverse primers from Table 1.
  2. PCR reaction setup:
    • 2 µL First-strand template
    • 1 µL Forward Primer
    • 1 µL Reverse Primer
    • 5 µL 10X HF Buffer
    • 1 µL dNTPs
    • 0.5 µL Phusion polymerase
    • x µL H2O to 50 µL
  3. PCR reactions are run under standard PCR conditions:
    • 98ºC 5 min
    • 35 cycles of:
    • 98ºC 15 sec
    • xºC for 30 sec*
    • 72ºC for ~45 sec/kb
    • 72ºC 10 min
    • 8ºC Hold

Annealing temperature is primer-dependent, but for most SARS-CoV primers in Table 1, annealing temperatures 52-55ºC will work.

Confirmation of PCR products and sequencing:

  1. Run PCR products (5 µL/reaction) on a 0.8% agarose/1X TAE gel to verify PCR success.
  2. Purify PCR products with PCR purification kit of choice (the Qiagen PCR Purification Kit works well).
  3. PCR products can be diluted to 150-200 µL/reaction to ensure that enough product is present for assembling sequencing reactions.
  4. Assemble sequencing reactions according to the primer/amplicon combinations outlined in Table 2.

Timing

  • Reverse transcription: 1-1.5 h
  • PCR: 2-4 h
  • Sequencing: facility-dependent

Anticipated Results

Primers have been designed to give clean, single-band PCR products. If multiple bands are detected, alternate annealing temperatures may be required. It may also be possible that alternate bands indicate multiple genome patterns at that locus.

Figures

Table 1: MERS-CoV Sequencing Primers

HCoV-EMC Primers

1F 3-22 GGCCGCATTAATACGACTCA

2F 103-122 AAAGCCCTGTTGTTTAGCGT

3F 305-324 CATGTCTTTCGTGGCTGGTG

4F 785-804 TGAGCGAGACAACACCTCTT

5F 1291-1310 ACATTTACCACTCCGCATTC

6F 1787-1806 TGTTGTCCTCGCAATTCTCT

7F 2381-2400 GGTGGTCAATGGCAAAGTTT

8F 2885-2904 CTTTGGCGGTGATCAAGTAC

9F 3377-3396 TGTGCAAGAAGAAGCACAAC

10F 3837-3856 GCTAAAGGGCCGTTACAAGT

11F 4285-4304 CAGTTGACGGTGTGCAATAT

12F 4917-4936 GCAGACAATTTGACTGCTGA

13F 5307-5326 TGGAGAGAGTGGTGCAATGT

14F 5895-5914 GGCGGTGATGCTATTAGTTT

15F 6427-6446 TGCTTAGATTGCACACCGTT

16F 6923-6942 GTTTGAAGATGCCCAAGGTT

17F 7531-7550 GCGGTATTTCATTCTGTCGT

18F 8035-8054 TCACACGCGATAAGTTGGAA

19F 8393-8412 GGATGCACTTAAACGACAGA

20F 8867-8886 TACTACATTGGCTTGGGTGA

21F 9407-9426 TATAGGTTTGTGTGCGTTCC

22F 10073-10092 CAGTGGAGATGTTGAGGCTT

23F 10691-10710 ACTTAATGGTTGCGCTTGGT

24F 11123-11142 GGCCTTCGTTATGTTGTTGG

25F 11551-11570 TTGCTTACTCACCACAGCTT

26F 12121-12140 CCTTTGCTGAGTTGGAAGCT

27F 12667-12686 CTTCTGCCGTTAAGTTGCAA

28F 13219-13238 ATGGTGGAGCTTCAGTGTGT

29F 13885-13904 TGGTTGCTGTGATGTTACCT

30F 14433-14452 AGATCTTTGTTGATGGCGTG

31F 14965-14984 TGGCAAAGCTCGTGTCTATT

32F 15415-15434 TGCTCAGGTGCTAAGCGAAT

33F 15999-16018 TCATGGTAGAGCGGTTTGTG

34F 16305-16324 TTCTCTGCTGTAAATGCTGC

35F 16749-16768 CCAAACCACCACTCAATCGT

36F 17337-17356 CCGATATTCTGGTGGTTGAT

37F 17877-17896 AAACAGCAGATACGGCACAT

38F 18287-18306 ATAGGCTTCGATGTTGAGGG

39F 18887-18906 ATAGAACGTGTGGATTGGGA

40F 19255-19274 TTGTGATGGCGGTAGTTTGT

41F 19839-19858 GCTACAAGTTCGTCCTTTGG

42F 20357-20376 AAGAAGCAACAGGAAGGTCA

43F 20813-20832 CCTGCCAATATGCGTGTTAT

44F 21117-21136 TTGGTGGGTCTGTTGCTATT

45F 21629-21648 TGTTTCTAAGGCTGACGGTA

46F 22001-22020 CGATGGATGTGGCACTTTAC

47F 22327-22346 CCACCTTGCCTGTTTATGAT

48F 22863-22882 GCTGGTCCAATATCCCAGTT

49F 23363-23382 GCAGCGCTTTGTTTATGATG

50F 23995-24014 CCAATTTACGCCAGGATGAT

51F 24615-24634 GGTGCTATTTCCGCCTCTAT

52F 25065-25084 GAGCCCATTACCTCCCTTAA

53F 25521-25540 CCGCATAAGGTTCATGTTCA

54F 25951-25970 ATCCCTAAACCCACAGCTAA

55F 26609-26628 AAGGATTGGCTTCTCGTTCA

56F 27045-27064 CTTGTCGTCGCAGCATTATC

57F 27487-27506 AACGCGCGATTCAGTTCCTC

58F 27941-27960 TTGCATGGTCCCTGATCTTT

59F 28427-28446 GGCAAAGCTACGGAACTAAT

60F 29003-29022 GCGGAACCCTAACAATGATT

61F 29603-29622 TGACCCAAAGAATCCCAACT

62F 29843-29862 AAAGTAACAAGATCGCGGCA

1R 138-157 TTAATGCCACAATCCCACCA

2R 640-659 GCCAACCAGACTGCCATTTG

3R 1062-1080 CTTTACGCTCAACATGCCA

4R 1570-1589 GCCACCAAAGATAAGTGTGA

5R 2108-2127 ACACACCAGAATCCATGTCA

6R 2382-2401 GAAACTTTGCCATTGACCAC

7R 2886-2905 TGTACTTGATCACCGCCAAA

8R 3458-3477 CAGTATCAGGCACAACAGGA

9R 3994-4013 TGCTGAAACAAGAGGAGTGA

10R 4566-4585 CCCTCGACTAAATGCCAAGA

11R 5162-5181 AATCACCGCCCTTATGTTTC

12R 5550-5569 GTTTCAATGCCCTGAAAGAC

13R 6048-6067 TTGCCTTTATACATGGCACC

14R 6582-6601 TGCCGCACTACACTCTTTAT

15R 7180-7199 GTATGCCAAACCAGTCTCAA

16R 7612-7631 GAGGTCATTTGCGACTTCTT

17R 8036-8055 TTTCCAACTTATCGCGTGTG

18R 8542-8561 CGTAAAGTCACGCAACGCAT

19R 9042-9061 GGATCATGGCAGTATGGTGT

20R 9496-9515 AACAGCAGCAACAACAGCAA

21R 10076-10095 TACAAGCCTCAACATCTCCA

22R 10566-10585 AATGCTGAACCGGTATGTGT

23R 109866-11005 AACCAATGCGCAGTACCATA

24R 11226-11245 GCTGACGAAATGGGAGTAGT

25R 11926-11945 GCATTTAACACAGAAAGCCC

26R 12474-12493 TCAGGAATTACAACGCGAAG

27R 12994-13013 CAATCTAACAGTCGCAGCAA

28R 13616-13635 TGATGCCCTTGGTCATCTAA

29R 14184-14203 TGTCTCAGCGGCCAGACAAT

30R 14630-14649 CCAGTTGTAAGTGCAGCGAC

31R 15140-15159 TTCTGATGGTACTGGCGATT

32R 15532-15551 TGACATTAGCAGTTGTCGCC

33R 16010-16029 ATAGCCAAAGACACAAACCG

34R 16596-16615 TGTTGTAGTATTGGCAAGGG

35R 17170-17189 CACACAAAGCATCAACAGCT

36R 17658-17677 CGTCACATTGCCCTTATAGA

37R 18198-18217 ATCGAGTTTAAAGCCCATCC

38R 18742-18761 GAACATCGACAAAGAAAGGG

39R 19238-19257 CAACCTGGCAAATTGAACTC

40R 19838-19857 CAAAGGACGAACTTGTAGCA

41R 20358-20377 ATGACCTTCCTGTTGCTTCT

42R 20812-20831 TAACACGCATATTGGCAGGC

43R 21118-21137 TAATAGCAACAGACCCACCA

44R 21628-21647 ACCGTCAGCCTTAGAAACAT

45R 22092-22111 GGAGTGTGATAAGTGGCAAA

46R 22636-22655 GCCAGACAGAAGAGGTGAAA

47R 23084-23103 AATAATCACCGTCTTCCCAC

48R 23570-23589 TAGAATCTCGCCGTTTAAGC

49R 23994-24013 TCATCCTGGCGTAAATTGGC

50R 24616-24635 AATAGAGGCGGAAATAGCAC

51R 25066-25085 ATTAAGGGAGGTAATGGGCT

52R 25522-25541 GTGAACATGAACCTTATGCG

53R 25946-25965 TGTGGGTTTAGGGATGTACA

54R 26326-26345 GTAAATGATGACCCGAACGT

55R 26870-26889 AATAAAGACGCCGAGAAAGC

56R 27450-27469 GGAAACATTGCCGTTTAAGG

57R 27940-27959 AAGATCAGGGACCATGCAAA

58R 28506-28525 ATGCAAGTTCAATATCCGCC

59R 29004-29023 GAATCATTGTTAGGGTTCCG

60R 29590-29609 TGGGTCAAGTTTAATGGCTC

61R 30034-30053 GGCACTGTTCACTTGCAATC

Table 2: MERS-CoV Amplicon Primer Sets

Table 2

Source: Protocol Exchange. Originally published online 10 July 2014.

DOI

Average rating 0 ratings