Plants

scientificprotocols authored about 3 years ago

Author: Pat Heslop-Harrison

Abstract:

Retroelements and their derivatives are an ubiquitous and abundant component of plant genomes. From the 1990s, PCR based techniques have been developed to isolate the elements from genomic DNA of different plants, and the methods and primers used are presented here.

Major classes of retroelements include the Ty1-copia, the Ty3-gypsy and the LINE (non-LTR) groups. Mixed PCR products representing the full heterogeneous pool of retrotransposons from each group are obtained by PCR with degenerate primers (degenerate nucleotide symbols link), as listed below. Some of the species tested are also listed, but experience of us and many others is that the primers succeed in most or all cases. Undegenerate primers for amplifying individual transposons are obtained from sequences in the databases. PCR protocols and programmes are given at the bottom of the page.

Revision 12/6/03: reduced amount of Taq polymerase recommended (we use enzyme from BioLine).

Ty1-copia Degenerate Primers

These work for virtually every higher plant species (tested in over 75 species, failed in one). Upstream Primer: 5'ACNGCNTTYYTNCAYGG encoding TAFLHG Downstream Primer: 5'ARCATRTCRTCNACRTA encoding YVDDML (in reverse). These two primers, from Flavell et al. (1992 a and b below), amplify a band of approximately 270bp. The primer pair 5'CARATGGARGTNAARAC encoding QMDVKT and 5'CATRTCRTCNACRTA encoding YVDDM (missing the L at the end of the Flavell primers) is used by Hirochika and Hirochika (1993 below).

Original papers are by three groups at about the same time: Flavell AJ, Smith DB, Kumar A. 1992 Extreme heterogeneity of Ty1-copia group retrotransposons in plants. Mol Gene Genet 231: 233-242 Flavell AJ, Dunbar E, Anderson R, Pearce SR, Hartley R, Kumar A. 1992. Ty1-copia group retrotransposons are ubiquitous and heterogeneous in higher plants. Nucleic Acids Res. 20: 3639-3644.

Voytas DF, Cummings MP, Konieczny A, Ausubel FM, Rodermel SR. 1992. copia-like retrotransposons are ubiquitous among plants. Proc.Natl.Acad.Sci.USA 89: 7124-7128

Hirochika H, Hirochika R. 1993. Tyl-copia group retrotransposons as ubiquitous components of plant genomes. Jpn J Genet 68: 35-46; Hirochika H, Fukuchi A, Kikuchi F. 1992. Retrotransposon families in rice. Mol.Gen.Genet. 233: 209-216.

gypsy Element Degenerate Primers

We (Heslop-Harrison and colleagues) have used the following in Hordeum (Vershinin et al., 2002), sugar beet (Kubis et al. 1998) and a variety of gymnosperms (Friesen et al. 2001, the original reference for these primers; see references page of this website for the citations).

  1. Forward primers: GyRT1 : 5' MRNATGTGYGTNGAYTAYMG encoding RMCVDYR GyRT3 : 5' YKNWSNGGNTAYCAYCARAT encoding LSGYHQI
  2. Reverse primers
    • GyRT4 : 5' RCAYTTNSWNARYTTNGCR encoding YAKLSKC
    • GyRT1/GyRT4 will give a 420bp product. GyRT3/ GyRT4 will give an approx 300bp product.
    • These were published in Friesen et al. 2001, Kubis et al. 1998
  3. Forward primer: 5' GTITAWYKTIGAYGAYRTIYTIRT Reverse primer: 5' ICKYTCISWYTGICCRTCISTYTGIGG
  4. These are still unpublished or were in Molecular Biology and Evolution 2000. They work well in 4 out of 4 species tested to date (beans'n nematodes). Andy Flavell can send you aliquots of these if you want to use them.

LINE Element Degenerate Primers

These work well in Hordeum, Allium, Oryza, Secale, Nicotiana and Antirrhinum. 5' RVNRANTTYCGNCCNATHTC 3' (named BEL1) encoding [E/D/K/N/S][E/D/N] FRPIS 3' TCYGTCCCCCTRGGRRACAG 5' (BEL2) encoding RQGDPLS (very similar to Andy's downstream primer) Bel1/Bel2 PCR products should be approximately 410bp.

Modified with changed specificity at the 3' end by Sybille Kubis et al., 2002 Plant Molecular Biology, work well in oil palm and Brassica (Alix et al, to be submitted) and mosses, ferns and liverwords (Elsebeth Kolmos)

BEL1MF: 5'-RVNRANTTYCGNCCNATHAG-3' and

BEL2MR: 5'-GACARRGGRTCCCCCTGNCK-3'.

These work well in Vicia. Upstream Primer: 5' CCNGGNCCNGAYGGNWT encoding PGPDG[IMF] Downstream Primer: 5' SWNARNGGRTCNCCYTG encoding QGDPLSP or: 5' SWNARNGGRCANCCYTG encoding QGCPLSP These primers together amplify a band of approximately 650bp.

PCR Programmes

Typical Mix for PCR amplification: We use 50 ul for both running on a gel and cloning, 15 ul for analysis of amplification alone. We use a Biometra T-gradient PCR machine.

Table 1

The above protocol is designed to be very reliable. For larger scale and greater specificity, reduce volume to 25 ul or 15 ul, use 0.1 U Taq polymerase per tube and 25% of above primer concentrations. A 'no DNA' control is essential; at different times, we have had major problems with false positive amplifications, so now buy water from Sigma (or other molecular biology supply companies) for use in PCR, DNA dilution, cloning experiments and other critical applications using at most 100s of microlitres. Single-primer controls are also useful to run as some species have nested retroelements in inverted orientations. It is instructive to make 'dirty' controls - with tiny amounts of dust from the lab, your pockets, your hair, powder from gloves etc. (use a tiny amount: the same 'dirt' will inhibit the real reactions, and this inhibition can also be tested in with DNA controls). In a recent course, about 30% of the 'dirty' controls gave amplification products, compared to 5% of clean controls.

  • Cycling conditions:
    • 94 °C, 3 mins
    • [39 °C / 50 secs,
    • 72 °C / 40 secs,
    • 94 °C / 1 min] X 30 cycles
    • 72 °C / 5 mins
    • 4 °C hold

Because the products are short, we usually analyse the products on 2% agarose gels, although note these are expensive and may make subsequent cloning more difficult. However, PCR product cloning kits such as the Invitrogen Topo AT cloning kit or Promega P-Gem T have overcome the difficulties of a few years ago.

Andy Flavell uses the following PCR temperatures (Techne Genius or ancient Hybaid) 95o 1 min [45oC / 1min, 72oC/ 1min, 94oC / 1 min] X 30 cycles 72oC / 7 mins

Specific LTR Primers for SSAP, REMAP and IRAP BARE-1 5' CTAGGGCATAATTCCAACAA. This corresponds to the first 19 bases of the BARE-1 LTR, facing outwards from the 5' LTR, plus one selective A base to inhibit internal priming within the BARE-1 element from the 3' LTR (see Waugh, Flavell et al 1997 for reference).

Thv19 5' GCCCAACCGACCAGGTTGTTACAG, corresponding to bases 48- Some of this work was carried out under EU Framework IV projects TEBIODIV (coordinated by Dr Andy Flavell, University of Dundee) and a Gymnosperm retroelement EU grant (David Marshall, SCRI)

Nucleotide degeneracies

R = A + G; Y = C + T; M = A + C; S= G + C; W = A + T; and N = A + G + C + T.

DOI

Average rating 0 ratings