Viruses Microbiology Genetics and Genomics

scientificprotocols authored about 3 years ago

Authors: Rachel Graham

Abstract

This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of Bt-CoV HKU5 genomes.

Introduction

This protocol details the steps, reagents, and conditions required to sequence Bt-CoV HKU5 genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that BtCoV HKU5 RNA purified using a standard procedure (i.e., TRIzol extraction) has already been performed.

Materials

  1. Invitrogen SuperScript III kit
  2. dNTPS (10 mM)
  3. Random Hexamers
  4. RNasin (if desired)
  5. Thermo Phusion PCR enzyme
  6. Primers (2 mM stock – see Tables 1 and 2)
  7. Agarose
  8. 1X TAE Buffer
  9. Ethidium Bromide

Equipment

  1. 70ºC water bath
  2. 55ºC water bath
  3. Thermal cycler

Procedure

Reverse Transcription:

  1. In a 1.5-µL Eppendorf tube, add 1-4 µL RNA and 1 µL Random Hexamers.
  2. Incubate at 70ºC for 5 min.
  3. Place reaction briefly on ice and assemble the reverse transcription reaction using the kit-supplied reagents (a master mix can be made if multiple reactions are being run):
    • 4 µL 5X First-Strand Buffer
    • 2 µL DTT
    • 1 µL SuperScript III reverse transcriptase
    • 1 µL dNTPs
    • 1 µL RNasin (if desired)
    • x µL H2O to 20 µL
  4. Incubate at 55ºC for 45 min to 1 h.
  5. Inactivate the reverse transcriptase at 70ºC for 15 min. Place reaction on ice after inactivation.
  6. Proceed with PCR setup.

PCR (with Phusion PCR kit):

  1. Assemble PCR reactions to generate amplicons according to those detailed in Table 3 (for whole-genome sequencing) or with any combination of forward and reverse primers from Tables 1 and 2.
  2. PCR reaction setup:
    • 2 µL First-strand template
    • 1 µL Forward Primer
    • 1 µL Reverse Primer
    • 5 µL 10X HF Buffer
    • 1 µL dNTPs
    • 0.5 µL Phusion polymerase
    • x µL H2O to 50 µL
  3. PCR reactions are run under standard PCR conditions:
    • 98ºC 5 min
    • 35 cycles of:
    • 98ºC 15 sec
    • xºC for 30 sec*
    • 72ºC for ~45 sec/kb
    • 72ºC 10 min
    • 8ºC Hold

Annealing temperature is primer-dependent, but for most SARS-CoV primers in Tables 1 and 2, annealing temperatures 52-55ºC will work.

Confirmation of PCR products and sequencing:

  1. Run PCR products (5 µL/reaction) on a 0.8% agarose/1X TAE gel to verify PCR success.
  2. Purify PCR products with PCR purification kit of choice (the Qiagen PCR Purification Kit works well).
  3. PCR products can be diluted to 150-200 µL/reaction to ensure that enough product is present for assembling sequencing reactions.
  4. Assemble sequencing reactions according to the primer/amplicon combinations outlined in Table 3..

Timing

  • Reverse transcription: 1-1.5 h
  • PCR: 2-4 h
  • Sequencing: facility-dependent

Anticipated Results

Primers have been designed to give clean, single-band PCR products. If multiple bands are detected, alternate annealing temperatures may be required. It may also be possible that alternate bands indicate multiple genome patterns at that locus.

Figures

Table 1: Bt-CoV HKU5 Sequencing Primers

HKU5.5 Primers

HKU55 1F 25_F CCCTCTCTCTCGTTCTCTTG

HKU55 2F 587_F TACCAAAATGCAGCAGGAGA

HKU55 3F 1015_F GATTGTGTGGAATGTGCAAC

HKU55 4F 1576_F GCACTTTATTCCTCGTGCAA

HKU55 5F 2060_F ATCCCGTGTGATGTTACTGA

HKU55 6F 2530_F TGATCTCGTAATTCCTGGTG

HKU55 7F 2978_F GTGGATGTTGTGAAGGATGA

HKU55 8F 3598_F AATAAGTGACGATGTTCCCG

HKU55 9F 4010_F GTCAACTTTTATGGGCCACT

HKU55 10F 4497_F CTAAAGACTCATTGGCGGAC

HKU55 11F 4957_F CGATGGGGTTAATTTCAGGA

HKU55 12F 5460_F AGCTTACCACTCAAGCCAAA

HKU55 13F 5924_F GGGAATACTTGGGCTGATGT

HKU55 14F 6413_F CCAAAGGAGGATGTTAAACC

HKU55 15F 7046_F TCCACTTTACGCCTGCTTTT

HKU55 16F 7551_F TTACACACATCCCCTTGTTG

HKU55 17F 8087_F GATCGTGGCCAGGAAAATTT

HKU55 18F 8529_F ACCTTAACGCTGCTTCTGTT

HKU55 19F 9039_F TTACCGTGGCTGTTATTGCT

HKU55 20F 9482_F AATGGCTCTTGGGCTATCTA

HKU55 21F 10003_F TTGTAGTTTCCAGGATGCAG

HKU55 22F 10545_F TGGCTGTGGAATCTGCTAAC

HKU55 23F 10943_F CCAAATAAGACTGGAATCGC

HKU55 24F 11389_F TACGCTGTTTCTTTTGCCCA

HKU55 25F 11945_F TTTCGCTATCTCACGGGTAA

HKU55 26F 12544_F CGAGGATAAGAAGGCCAAGA

HKU55 27F 13010_F GTTGAGGGTCGTAAAATGCT

HKU55 28F 13543_F ACATGTTCGTGATCCTGTTG

HKU55 29F 14050_F GCTTTGAGGCACTTTGATCA

HKU55 30F 14536_F CAGCAGTATCACCCAAATTG

HKU55 31F 14959_F TCCTCAGTCACATTAAGGCA

HKU55 32F 15338_F GTGTTTCGATCCTTAGCACA

HKU55 33F 15866_F GCCAACCTGACCCTAAATTT

HKU55 34F 16461_F TGTCGGATCTTGTGTCGTGT

HKU55 35F 16936_F GAGCGTGAATTGTTGCTTGT

HKU55 36F 17450_F CACGCATTATACCTGCGAAA

HKU55 37F 17914_F TCTGCCATTAACAGACCTCA

HKU55 38F 18446_F CGATACCCAACTACCCAAAA

HKU55 39F 18906_F TTCGCCGTTACACTCTTATG

HKU55 40F 19466_F TCAATTTGCCTGGTTGCGAT

HKU55 41F 20070_F GTTTGTGCTCTGGGATTACG

HKU55 42F 20530_F GAGCATGTGGTTTATGGTGA

HKU55 43F 20946_F CATGCTGCCTAATTACAAGC

HKU55 44F 21434_F CATGGTGGACTGTGTTTTGC

HKU55 45F 22095_F TTGTTCGTATTGGAGCAGCT

HKU55 46F 22501_F TGCTGAGTGGTTTGGCATTA

HKU55 47F 23132_F GCTGGAGAAATTGTGCAGTT

HKU55 48F 23557_F TCATGGCATAACAGGAAGAG

HKU55 49F 24026_F CCTTTAACACTCGCACCAAT

HKU55 50F 24533_F CCACCCTTATATGACCCCTA

HKU55 51F 24943_F TGGCCGTCTTACATCTCTTA

HKU55 52F 25536_F AGTTGATGGTGCTGAGTGAA

HKU55 53F 25968_F GCTGGCATGTACACTAATCG

HKU55 54F 26510_F CTAAGCGCCGTTTTACTCCT

HKU55 55F 27000_F ACATTCTCACACCACCGAAT

HKU55 56F 27566_F TTGCAGGCGGGGTTGTTATA

HKU55 57F 28012_F CGGCTATTCGATTATGTGTG

HKU55 58F 28470_F TTCGGCTGTTTATGCGCACT

HKU55 59F 28928_F CAATGAAACCCCTACCAACA

HKU55 60F 29436_F AGAAACGGAAGAAGCAACAG

HKU55 61F 29990_F AAGTGGTGATGATGCTGCTA

HKU55 62F 30150_F CCCGATTCAGAGGCATAAAT

HKU55 1R 420_R CTTTCGCCGTCCATAAACCA

HKU55 2R 1024_R CCACACAATCCGGTACAATT

HKU55 3R 1593_R GCACGAGGAATAAAGTGCAT

HKU55 4R 2079_R TCAGTAACATCACACGGGAT

HKU55 5R 2549_R CACCAGGAATTACGAGATCA

HKU55 6R 2996_R CATCCTTCACAACATCCACA

HKU55 7R 3475_R CTTGGCAACTTCAGCATCAT

HKU55 8R 4028_R GTGGCCCATAAAAGTTGACA

HKU55 9R 4594_R TGCTAAGTCAAGCCCATGAG

HKU55 10R 4975_R CCTGAAATTAACCCCATCGA

HKU55 11R 5479_R TTTGGCTTGAGTGGTAAGCT

HKU55 12R 5942_R CATCAGCCCAAGTATTCCCA

HKU55 13R 6432_R GGTTTAACATCCTCCTTTGG

HKU55 14R 6935_R CAACTTTAACGGTGCTTTGG

HKU55 15R 7570_R CAACAAGGGGATGTGTGTAA

HKU55 16R 8109_R GCTAAATTTTCCTGGCCACG

HKU55 17R 8548_R AACAGAAGCAGCGTTAAGGT

HKU55 18R 9058_R AGCAATAACAGCCACGGTAA

HKU55 19R 9543_R TCACCACAATAGACACCAGG

HKU55 20R 10022_R CTGCATCCTGGAAACTACAA

HKU55 21R 10564_R GTTAGCAGATTCCACAGCCA

HKU55 22R 10962_R GCGATTCCAGTCTTATTTGG

HKU55 23R 11408_R TGGGCAAAAGAAACAGCGTA

HKU55 24R 11964_R TTACCCGTGAGATAGCGAAA

HKU55 25R 12563_R TCTTGGCCTTCTTATCCTCG

HKU55 26R 13028_R GCATTTTACGACCCTCAACA

HKU55 27R 13501_R TGTGACATCTGGGTGCTCTA

HKU55 28R 14070_R CTGATCAAAGTGCCTCAAAG

HKU55 29R 14552_R TTTGGGTGATACTGCTGATC

HKU55 30R 15050_R ATCGTTGGCAGGTTGTAAGC

HKU55 31R 15539_R ATAGCGCGATCACACTTAGG

HKU55 32R 15890_R TCCACAAATTTAGGGTCAGG

HKU55 33R 16473_R ACAAGATCCGACAGCCTGAA

HKU55 34R 16990_R GATTAAGTGGTGGTTTGGCT

HKU55 35R 17557_R ACGTTTCTGGCAGTGCATTA

HKU55 36R 17926_R TGTTAATGGCAGAGCTAGCA

HKU55 37R 18502_R TGACTTGCCTTATAGCCTCA

HKU55 38R 18930_R GCAGGCATAAGAGTGTAACG

HKU55 39R 19485_R ATCGCAACCAGGCAAATTGA

HKU55 40R 20090_R TCGTAATCCCAGAGCACAAA

HKU55 41R 20548_R CACCATAAACCACATGCTCA

HKU55 42R 20965_R GCTTGTAATTAGGCAGCATG

HKU55 43R 21450_R AAACACAGTCCACCATGCAA

HKU55 44R 21837_R TGAGACCGTAGACATGAACC

HKU55 45R 22468_R GAACGTGCAATTGATCAGGT

HKU55 46R 22896_R TCTTGAGTTGTTGCCTGTTC

HKU55 47R 23496_R TGCATGGGACAGACACTATT

HKU55 48R 24044_R TTGGTGCGAGTGTTAAAGGA

HKU55 49R 24445_R CATATAGCCAGGATCAGCAA

HKU55 50R 24958_R AGATGTAAGACGGCCATTGA

HKU55 51R 25455_R AATTCCTCCAGCTCATCCTT

HKU55 52R 25978_R TACATGCCAGCCGTATCAAA

HKU55 53R 26433_R GCTCGAAGGCTGTGCTATAA

HKU55 54R 27016_R CGGTGGTGTGAGAATGTTTA

HKU55 55R 27585_R TATAACAACCCCGCCTGCAA

HKU55 56R 28047_R AACCAGAAACACACTGCACA

HKU55 57R 28489_R AGTGCGCATAAACAGCCGAA

HKU55 58R 28982_R TCTGGGCTTAGTTCTTGGAC

HKU55 59R 29455_R CTGTTGCTTCTTCCGTTTCT

HKU55 60R 29913_R TGTAGTTGGGATTCTTTGGG

HKU55 61R 30391_R GCACTGTTCACTTGCAATCT

Table 2: SARS-CoV Sequencing Primers

Table 2

Table 3: Bt-CoV HKU5 Amplicon Primer Sets

Table 3

Associated Publications

A Mouse Model for Betacoronavirus Subgroup 2c Using a Bat Coronavirus Strain HKU5 Variant S. Agnihothram, B. L. Yount, E. F. Donaldson, J. Huynh, V. D. Menachery, L. E. Gralinski, R. L. Graham, M. M. Becker, S. Tomar, T. D. Scobey, H. L. Osswald, A. Whitmore, R. Gopal, A. K. Ghosh, A. Mesecar, M. Zambon, M. Heise, M. R. Denison, and R. S. Baric, mBio 5 (2) e00047-14 - e00047-14 25/03/2014

Source: Protocol Exchange. Originally published online 10 July 2014.

DOI

Average rating 0 ratings