Viruses Genetics and Genomics Microbiology

scientificprotocols authored over 3 years ago

Authors: Rachel Graham

Abstract

This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of Bt-CoV HKU3 genomes.

Introduction

This protocol details the steps, reagents, and conditions required to sequence Bt-CoV HKU3 genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that BtCoV HKU3 RNA purified using a standard procedure (i.e., TRIzol extraction) has already been performed.

Materials

  1. Invitrogen SuperScript III kit
  2. dNTPS (10 mM)
  3. Random Hexamers
  4. RNasin (if desired)
  5. Thermo Phusion PCR enzyme
  6. Primers (2 mM stock – see Tables 1 and 2)
  7. Agarose
  8. 1X TAE Buffer
  9. Ethidium Bromide

Equipment

  1. 70ºC water bath
  2. 55ºC water bath
  3. Thermal cycler

Procedure

Reverse Transcription:

  1. In a 1.5-µL Eppendorf tube, add 1-4 µL RNA and 1 µL Random Hexamers.
  2. Incubate at 70ºC for 5 min.
  3. Place reaction briefly on ice and assemble the reverse transcription reaction using the kit-supplied reagents (a master mix can be made if multiple reactions are being run):
    • 4 µL 5X First-Strand Buffer
    • 2 µL DTT
    • 1 µL SuperScript III reverse transcriptase
    • 1 µL dNTPs
    • 1 µL RNasin (if desired)
    • x µL H2O to 20 µL
  4. Incubate at 55ºC for 45 min to 1 h.
  5. Inactivate the reverse transcriptase at 70ºC for 15 min. Place reaction on ice after inactivation.
  6. Proceed with PCR setup.

PCR (with Phusion PCR kit):

  1. Assemble PCR reactions to generate amplicons according to those detailed in Table 3 (for whole-genome sequencing) or with any combination of forward and reverse primers from Tables 1 and 2.
  2. PCR reaction setup:
    • 2 µL First-strand template
    • 1 µL Forward Primer
    • 1 µL Reverse Primer
    • 5 µL 10X HF Buffer
    • 1 µL dNTPs
    • 0.5 µL Phusion polymerase
    • x µL H2O to 50 µL
  3. PCR reactions are run under standard PCR conditions:
    • 98ºC 5 min
    • 35 cycles of:
    • 98ºC 15 sec
    • xºC for 30 sec*
    • 72ºC for ~45 sec/kb
    • 72ºC 10 min
    • 8ºC Hold

Annealing temperature is primer-dependent, but for most SARS-CoV primers in Tables 1 and 2, annealing temperatures 52-55ºC will work.

Confirmation of PCR products and sequencing:

  1. Run PCR products (5 µL/reaction) on a 0.8% agarose/1X TAE gel to verify PCR success.
  2. Purify PCR products with PCR purification kit of choice (the Qiagen PCR Purification Kit works well).
  3. PCR products can be diluted to 150-200 µL/reaction to ensure that enough product is present for assembling sequencing reactions.
  4. Assemble sequencing reactions according to the primer/amplicon combinations outlined in Table 3.

Timing

  • Reverse transcription: 1-1.5 h
  • PCR: 2-4 h
  • Sequencing: facility-dependent

Anticipated Results

Primers have been designed to give clean, single-band PCR products. If multiple bands are detected, alternate annealing temperatures may be required. It may also be possible that alternate bands indicate multiple genome patterns at that locus.

Table 1: Bt-CoV HKU3 Sequencing Primers. Bt-CoV HKU3 Sequencing Primers

1 BSStartF CCTACCCAGGAAAAGCCAAC

2 BS76F TAAAATCTGTGTGGCTGTCG

3 BS379F TTATCGGAGGCACGTGAACA

4 BS654F AGCCGGTGGTCATAGTTTTG

5 BS950F ACTGCTGCCGTGAACATGAA

6 BS1484F GCGGCTGTGTATTTTCCTAT

7 BS1904F TTTTCTCTCGCACACTGGAT

8 BS2464F AAGGCACCAAAAGAAGTCAC

9 BS3030F TTGCTCTTTCTACCCTCCTG

10 BS3475F ACAGTTGGAGGCTCATGTTT

11 BS4083F TAAGAAGTCGGGTGGGACTA

12 BS4429F GGTGTCCGGTTCTTCTTCTA

13 BS4909F AACCTCCACACGCATATTGT

14 BS5464F AAGGGTGTAGAGGCTGTGAT

15 BS6041F TAACCGTCACATTCTTCCCA

16 BS6557F CCGCTGCAATAAATAGTGTC

17 BS7023F TCAGGGTTATTTTCCCTGCA

18 BS7455F TGTCAATGGCGTGAAGAGAT

19 BS8058F TGGTGTCCTTTCTACATTCG

20 BS8509F CTTTTGTGTGTTCTTGCTGC

21 BS8916F CGTTTTGGCTGCTGAATGTA

22 BS9401F ACCATGTTGTTGCCGCTAAT

23 BS10049F ATGGTTTGTGGTTGGATGAC

24 BS10432F TGCGTGTCTTTCTGCTACAT

25 BS10842F GCCCTTTGACGTTGTTAGAC

26 BS11282F ATGATGCTGCTAGACGTGTG

27 BS11709F GTTGGGCATTGGAGGTAAAC

28 BS12142F TCTGAGTTTGACCATGATGC

29 BS12500F TTGTCCAGCTCAGTGAAATC

30 BS12975F GCTTTCTTTCTGTGCTTTCG

31 BS13469F CGAGAAAGTTGCTGGTTTTG

32 BS13924F AATTCTGCGATGCTATGCGT

33 BS14442F TCACGCCTCAGTTTTAAGGA

34 BS14948F GCGTAATGTCATCCCTACAA

35 BS15500F TGATAAGTACGTCCGCAATC

36 BS15941F AATTGACGCCTACCCACTTA

37 BS16475F AGCGACATGTGATTGGACTA

38 BS17016F CACTTTGCTATTGGACTTGC

39 BS17354F AGCTCAATTACCTGCACCAC

40 BS17897F CAAGCTGCAATTTACGAGTC

41 BS18453F CAAATGCTCAGTGATACGCT

42 BS18991F ACTGGAAATTCTACGACGCT

43 BS19461F GCTGGATTTAGCCTTTGGAT

44 BS19887F CTCATTGTCTTGTTTGACGG

45 BS20558F CCCAAAATTACAGGCAAGTC

46 BS20900F ATTGATTGGAGACTGTGCCA

47 BS21261F TGGAGGAACACAAACCCTAT

48 BS21550F CGCAACCTAAAATGGCACAA

49 BS21931F ATGCCTGGGTTTATCAGAGT

50 BS22485F TTCCCTTCTGTCTATGCATG

51 BS22889F CCCACCTGCTCTTAATTGTT

52 BS23404F AGCATGTCAACGCCTCTTAT

53 BS23816F GGACTTTGGCGGTTTCAATT

54 BS24103F GTGCAGCTCTTCAAATACCA

55 BS24664F CTCCAGCTATTTGTCACGAA

56 BS25073F GTATGTTTGGCTCGGCTTTA

57 BS25402F TTGTTGGCGTTGCACTTCTT

58 BS25992F CAAATACACACAATCGACGG

59 BS26434F ACTCCTGGAACAATGGAATC

60 BS26925F ACAAATTAGGAGCGTCGCAG

61 BS27500F GTGCAAGATCAGTTTCACCA

62 BS27920F TGGATCTAGAAAATCGGCTC

63 BS28445F GACGGCAAAATGAAAGAGCT

64 BS28861F TAAAGGCCAACAACAACCAG

65 BS29235F AAACATTCCCACCAACAGAG

66 BS29601F AAGAGCCACCACATTTTCAC

1 BS474R GAACACATAGGGCTGTTCAA

2 BS969R TTCATGTTCACGGCAGCAGT

3 BS1497R AAATACACAGCCGCCAAAAC

4 BS1923R ATCCAGTGTGCGAGAGAAAA

5 BS2438R TCTTTGCCACGAATACACTG

6 BS2820R CTTATCCACTCGCACATCAA

7 BS3471R AGGTCCATTTTGCCTGATGT

8 BS3636R AGCTGACAATAGAGGTGCAA

9 BS4113R TAGCATTTCCGTAGTCCCAC

10 BS4394R TTATACTTGCGCTGGATGGT

11 BS4927R CAATATGCGTGTGGAGGTTA

12 BS5480R ACAGCCTCTACACCCTTCAA

13 BS6060R TGGGAAGAATGTGACGGTTA

14 BS6577R GGACACTATTTATTGCAGCG

15 BS7040R CAGGGAAAATAACCCTGACA

16 BS7474R ATCTCTTCACGCCATTGACA

17 BS8077R CGAATGTAGAAAGGACACCA

18 BS8528R GCAGCAAGAACACACAAAAG

19 BS8935R TACATTCAGCAGCCAAAACG

20 BS9420R ATTAGCGGCAACAACATGGT

21 BS9975R AAAACCACTCTGCAAAACCG

22 BS10451R ATGTAGCAGAAAGACACGCA

23 BS10861R GTCTAACAACGTCAAAGGGC

24 BS11227R TAACACAGTCCTTAAGCCGA

25 BS11728R GTTTACCTCCAATGCCCAAC

26 BS12222R CTGCTTGTACATTTGGGTCA

27 BS12519R GATTTCACTGAGCTGGACAA

28 BS12994R CGAAAGCACAGAAAGAAAGC

29 BS13485R AACCAGCAACTTTCTCGTTG

30 BS13943R ACGCATAGCATCGCAGAATT

31 BS14461R TCCTTAAAACTGAGGCGTGA

32 BS14967R TTGTAGGGATGACATTACGC

33 BS15519R GATTGCGGACGTACTTATCA

34 BS15960R TAAGTGGGTAGGCGTCAATT

35 BS16494R TAGTCCAATCACATGTCGCT

36 BS17035R GCAAGTCCAATAGCAAAGTG

37 BS17180R ATCAAAACACTCTACACGCG

38 BS17630R ACCTATTTGTGGCCTGTTGA

39 BS17916R GACTCGTAAATTGCAGCTTG

40 BS18476R TTTCAGCGTATCACTGAGCA

41 BS18892R TGCTGTACTTTTCTGCATGC

42 BS19479R TCCAAAGGCTAAATCCAGCA

43 BS19906R CCGTCAAACAAGACAATGAG

44 BS20577R GACTTGCCTGTAATTTTGGG

45 BS20919R TGGCACAGTCTCCAATCAAT

46 BS21280R ATAGGGTTTGTGTTCCTCCA

47 BS21665R TGAGTCAAATGGCAGGAAGT

48 BS21950R ACTCTGATAAACCCAGGCAT

49 BS22417R TGAGTGGGTGAAACTCTGAA

50 BS22908R AACAATTAAGAGCAGGTGGG

51 BS23232R CACTAACACCACCAAAGGAA

52 BS23627R AGCCATTGAAACAGGCATCA

53 BS23835R AATTGAAACCGCCAAAGTCC

54 BS24122R TGGTATTTGAAGAGCTGCAC

55 BS24579R TAAGGTGGTAGCCTTTTCCA

56 BS25092R TAAAGCCGAGCCAAACATAC

57 BS25421R AAGAAGTGCAACGCCAACAA

58 BS25949R TGTAGCATTTTCAGCACCAG

59 BS26454R AGATTCCATTGTTCCAGGAG

60 BS26699R CAAACAGCCTGAAAGAAGCA

61 BS27301R GCGCTATCAATGTCAAGAAG

62 BS27939R GAGCCGATTTTCTAGATCCA

63 BS28465R GAGCTCTTTCATTTTGCCGT

64 BS28880R CTGGTTGTTGTTGGCCTTTA

65 BS29254R CTCTGTTGGTGGGAATGTTT

66 BS29620R GTGAAAATGTGGTGGCTCTT

67 BS29657R ATTCACTGTACCCTCGATCG

Table 2: Bt-CoV HKU3 Amplicon Primer Sets.

Table 2

Source: Protocol Exchange. Originally published online 10 July 2014.

DOI

Average rating 0 ratings